Amino acid methylation

Amino acid methylation DEFAULT

One-step process for production of N-methylated amino acids from sugars and methylamine using recombinant Corynebacterium glutamicum as biocatalyst

Abstract

N-methylated amino acids are found in Nature in various biological compounds. N-methylation of amino acids has been shown to improve pharmacokinetic properties of peptide drugs due to conformational changes, improved proteolytic stability and/or higher lipophilicity. Due to these characteristics N-methylated amino acids received increasing interest by the pharmaceutical industry. Syntheses of N-methylated amino acids by chemical and biocatalytic approaches are known, but often show incomplete stereoselectivity, low yields or expensive co-factor regeneration. So far a one-step fermentative process from sugars has not yet been described. Here, a one-step conversion of sugars and methylamine to the N-methylated amino acid N-methyl-l-alanine was developed. A whole-cell biocatalyst was derived from a pyruvate overproducing C. glutamicum strain by heterologous expression of the N-methyl-l-amino acid dehydrogenase gene from Pseudomonas putida. As proof-of-concept, N-methyl-l-alanine titers of 31.7 g L−1 with a yield of 0.71 g per g glucose were achieved in fed-batch cultivation. The C. glutamicum strain producing this imine reductase enzyme was engineered further to extend this green chemistry route to production of N-methyl-l-alanine from alternative feed stocks such as starch or the lignocellulosic sugars xylose and arabinose.

Introduction

N-alkylation of amino acids occur in bacteria and eukaryotes. In green tea leaves, the N5-ethylated L-glutamine derivative theanine was shown to be responsible for their umami taste1,2. N-methylated amino acids are also found in depsipeptides that are used as drugs e.g. vancomycin, actinomycin D and cyclosporine. N-methylamino acid containing peptides often show higher stability against proteolytic degradation and/or increased membrane permeability as compared to non-methylated peptides3,4,5. Accordingly, the substitution of an N-terminal glycine residue for sarcosine in an angiotensin II analog enhanced in vivo activity as a potential result of longer half-life against proteolytic degradation6. Similar to l-proline, N-methylated amino acids are known to stabilize discrete conformations of peptides as shown for the exchange of l-pipecolic acid by N-methyl-l-alanine in the ATPase inhibitor efrapeptin C7.

In certain bacteria, utilization of mono-methylamine (MMA) may lead to N-methylated amino acids. Some bacteria that can grow with reduced carbon substrates without carbon-carbon bonds such as methane or methanol can utilize MMA as sole source of carbon. The N-methylated amino acid N-methylglutamate occurs as an intermediate of the so-called monomethylamine catabolic pathway in representatives of these methylotrophic bacteria, e.g. Methylocella silvestris, Methyloversatilis universalis or Methylobacterium extorquens8,9,10,11. In cell free extracts of Pseudomonas MS N-methylalanine (NMeAla) was observed when MMA was added to the growth medium12. An enzyme which catalyzes the reductive methylamination of pyruvate to NMeAla in the presence of MMA was isolated and named N-methylalanine dehydrogenase (Fig. 1)13. Based on its native function of reducing piperideine-2-carboxylate in addition to the asymmetric synthesis of chiral amines this enzyme belongs to the class of imine reductases (IREDs)14,15. The corresponding gene dpkA from Pseudomonas putida ATCC12633 was identified and characterization of the encoded enzyme revealed a somewhat relaxed substrate spectrum. Since α-keto acids such as phenylpyruvate, ketohexanoate and ketoisobutyrate were accepted aside from pyruvate and the enzyme also converts other alkylamines such as N-ethylamine, it was named N-methyl-l-amino acid dehydrogenase or NMAADH16,17,18. Reductive alkylamination of α-keto acids by DpkA using MMA appears similar to reductive amination by amino acid dehydrogenases using ammonium. Yet, the structure of DpkA shows similarities to a new subclass of Nicotinamide adenine dinucleotide phosphate (NADPH)-dependent oxidoreductases with the rare SESAS (seven-stranded predominantly antiparallel β-sheet) fold for NADPH-binding19. The physiological role of NMAADH activity in pseudomonads, however, remains elusive.

Schematic overview of the reaction catalyzed by DpkA (A) and its integration into the central carbon metabolism in C. glutamicum NMeAla1 (B). The gene deletions for improved pyruvate production are shown by black arrows with red double bars: deletion of aceE (encoding PDHE1p, the E1p subunit of the PDHC) and pqo (encoding pyruvate-quinone oxidoreductase, PQO) and both genes coding both major enzymes for l-alanine supply by pyruvate aminotransferases (alaT and avtA, encoding the alanine aminotransferase AlaT and the valine-pyruvate aminotransferase AvtA, respectively) were deleted. In addition, the acetohydroxyacid synthase (AHAS) activity was downregulated by deletion of the C-terminal part of ilvN (small subunit of AHAS) shown by red dashed arrow. Enzymes highlighted by red background indicate missing or down regulated enzymes. The thick arrow displays the NMeAla formation by heterologous expressed dpkA from P. putida KT2440 coding for the N-methylated amino acid dehydrogenase DpkA (green shadowed Enzyme).

Full size image

Although the formation of N-alkylated amino acids such as NMeAla has been shown during the characterization of NMAADH16,17,18, efficient production via biocatalysis or by fermentation has not yet been described. Biocatalytic approaches may offer advantages over chemical methods such as N-alkylation of amino acids or the asymmetric Strecker synthesis since the chemical methods may use hazardous chemicals, give only incomplete stereoselectivity and low yields, while side reactions like dimethylation of the amino group may occur20.

Fermentative production of amino acids, mainly l-glutamate and l-lysine, occurs at the million-ton-scale21. For more than fifty years, C. glutamicum has been used for the safe production of food and feed amino acids22,23. Besides the flavor enhancing l-glutamate24 and the feed additive l-lysine25, further amino acids and related compounds can efficiently be produced by glucose- and ammonium-based fermentation using recombinant C. glutamicum strains26,27. Metabolic engineering of C. glutamicum has not been restricted to amino acids but also production of the α-keto acids pyruvate, ketoisovalerate and ketoisocaproate28,29,30,31 were established. Taking the broad substrate range of the NMAADH from P. putida into account, it is important to engineer a host such as C. glutamicum to overproduce only one α-keto acid, in this study pyruvate.

Here we describe the one-step production of the N-methylated amino acid NMeAla from glucose and methylamine by a newly constructed C. glutamicum whole cell biocatalyst. The NMAADH gene dpkA from P. putida was expressed in a pyruvate overproducing C. glutamicum strain31. This pyruvate producing strain, named ELB-P, is able to secrete up to 17.6 g L−1 pyruvate with low by-product formation in shake flasks31. To achieve high titers of pyruvate, the genome of this strain carries deletions of the genes encoding pyruvate-converting enzymes. Starting with a pyruvate dehydrogenase gene (aceE encoding the E1p subunit) deficient strain32, which accumulates high titers of pyruvate33, additional deletion of the pyruvate-quinone oxidoreductase gene (pqo)34 and deletion of the C-terminal regulatory domain of the acetohydroxyacid synthase gene (ilvN)35,36 further increased pyruvate availability. To prevent the reduction of pyruvate to lactic acid, the ldhA (NAD-dependent l-lactic acid dehydrogenase)35 was deleted. Additionally, formation of the by-product l-alanine was reduced by deletion of the alanine aminotransferase gene (alaT) and valine-pyruvate aminotransferase gene (avtA)37 (Fig. 1). C. glutamicum ELB-P requires acetate for biomass formation as consequence of the aceE deletion and uses glucose for production of pyruvate31,38. A derivative of C. glutamicum ELB-P expressing dpkA from P. putida was constructed here and demonstrated to be suitable for the one-step production of NMeAla from MMA and glucose or alternative feedstocks.

Results

Corynebacterium glutamicum as suitable host for NMeAla production

To determine if C. glutamicum is a suitable host for the production of the N-methylated amino acid NMeAla, the growth behavior of the wild type strain was analyzed under different conditions. To test whether C. glutamicum is able to utilize MMA or NMeAla as sole carbon or nitrogen source it was grown in minimal medium with either 50 mm MMA, NMeAla or glucose as sole carbon source or with either 50 mm MMA, 50 mm NMeAla or 30 mm ammonium sulfate and 17 mm urea as nitrogen source. This growth experiment revealed that C. glutamicum could neither use MMA nor NMeAla as sole carbon or nitrogen source (data not shown).

Possible effects due to substrate or product toxicity were detected in growth experiments with C. glutamicum wild type in minimal medium with glucose and increasing concentrations of MMA (0.05 m to 1.5 m) or NMeAla (0.05 m to 0.25 m). The growth rate was diminished at higher concentrations to about half-maximal rates at 1.8 m MMA and 0.4 m NMeAla, respectively (Fig. 2). In order to determine if MMA affects global gene expression in C. glutamicum, the transcriptomes were compared during growth in glucose minimal medium containing either 250 mm MMA or 125 mm ammonium sulfate. The finding that very few genes changed expression and none had a function in nitrogen metabolism (Supplementary Table) indicated that MMA does not elicit a specific gene expression response.

Growth rates of C. glutamicum wild type in the presence of varying concentrations of MMA or NMeAla. C. glutamicum wild type was grown in presence of increasing MMA (0.05 m to 1.5 m) or NMeAla (0.05 m to 0.25 m) concentrations and specific growth rates were determined. Half maximal growth rates were obtained by extrapolation.

Full size image

Metabolic engineering of C. glutamicum for fermentative production of NMeAla

The relatively small impacts of the substrate MMA and the product NMeAla on growth make C. glutamicum a suitable host organism for the fermentative production of NMeAla if a) sufficient pyruvate is available and b) NMeAla is transported out of the C. glutamicum cell. Therefore, the pyruvate overproducing C. glutamicum strain ELB-P31 was chosen as platform strain for engineering fermentative production of NMeAla. Since NMAADH activity had not been reported for C. glutamicum, the NMAADH gene dpkA from P. putida was cloned into the expression vector pVWEx1 and used to transform C. glutamicum ELB-P (Fig. 1). The resulting strain ELB-P(pVWEx1-dkpA) was designated as NMeAla1. Crude extracts of cells carrying either the empty vector or the dpkA expression vector were assayed for reductive N-methylamination of pyruvate. As presumed, no activity was detected for C. glutamicum carrying the empty vector whereas a specific activity of 24 ± 1 mU (mg protein−1) for reductive N-methylamination of pyruvate was detected in the dpkA expressing strain. This result indicates functional expression of dpkA from P. putida in C. glutamicum.

In order to test C. glutamicum strain NMeAla1 for NMeAla production, the strain was cultivated in minimal medium supplemented with 16.6 g L−1 potassium acetate, 2 mml-Ala, 30 g L−1 glucose and 3.1 g L−1 MMA. HPLC analysis of supernatants after cultivation for 72 h revealed that C. glutamicum NMeAla1 produced 7.6 ± 0.1 g L−1 NMeAla (Fig. 3). Only 0.2 ± 0.1 g L−1 pyruvate were produced, but the by-product l-alanine accumulated to considerable concentrations (4.3 ± 0.9 g L−1; Fig. 3).

NMeAla, l-alanine, l-valine and pyruvate production data (A) and carbon balance (B) of C. glutamicum strain NMeAla1 under different conditions. Cells were cultivated in minimal medium CGXII containing 30 g L−1 or 20 g L−1 glucose and 16.6 g L−1 potassium acetate, 2 mm l-Ala and 1 mm IPTG for induction of gene expression. The nitrogen amount of the minimal medium was reduced to 50% or 10% respectively, the glucose and MMA amount were optimized to finally 20 g L−1 glucose and 10.9 g L−1 MMA. The culture supernatants were harvested after incubation for 72 h and analyzed by HPLC. (A) Concentrations are given as means with standard deviation of three replicates. n.d.: not detected. (B) To assess the fate of carbon from glucose and acetate as substrates their concentrations in gram carbon per liter is plotted. The gram carbon per liter concentrations of biomass formed (green) and of the formed products l-alanine (blue), l-valine (black), pyruvate (grey), and NMeAla (red) are plotted. For NMeAla, the carbon derived from MMA was not considered. The gram carbon per liter concentrations of CO2 and unknown byproducts are depicted in open columns. Amines < 0.1 g L−1 and carbohydrates < 0.5 g L−1 were not considered.

Full size image

Improvement of precursor conversion and reduction of by-product formation

The formation of l-alanine as by-product may be due to the high concentrations of ammonium sulfate and urea present as nitrogen sources in CGXII minimal medium. CGXII minimal medium was optimized for production of l-lysine which contains two ammonium groups and reducing the nitrogen content in CGXII medium has previously been shown to improve production of l-proline and γ-aminobutyric acid that only contain a single ammonium group39,40. For production of NMeAla, MMA is used for reductive N-methylamination of pyruvate while ammonium sulfate and urea are required solely to support biomass formation. Therefore, the nitrogen amount of the minimal medium was reduced by half (2.5 instead of 5 g L−1 urea and 10 instead of 20 g L−1 ammonium sulfate) and to 10% (0.5 instead of 5 g L−1 urea and 2 instead of 20 g L−1 ammonium sulfate). Under the latter condition formation of the by-product l-alanine was diminished, however, increased pyruvate concentrations and decreased NMeAla concentrations in the supernatants indicated incomplete reductive N-methylamination of pyruvate to NMeAla (Fig. 3A). Subsequently, the MMA concentration was increased to 10.9 g L−1 and in addition the glucose concentration was reduced to 20 g L−1. As a result, only low concentrations of pyruvate, l-alanine and l-valine accumulated as by-products while a titer of 10.5 ± 0.4 g L−1 of NMeAla was obtained within 72 h (Fig. 3). To obtain an idea of the fate of carbon from glucose and acetate as substrates the concentrations of carbon present in the biomass and products formed were plotted (Fig. 3B). While E. coli shows overflow metabolism at high glucose concentrations, C. glutamicum does not22,23. Specifically, the strain used here did neither secrete acetate nor lactate due to gene deletions introduced by metabolic engineering (ΔaceE, Δpqo, ΔldhA). As expected for aerobic processes, about 50% of carbon from the growth substrates will end up in CO2. For example under the condition with 20 g L−1 glucose and 16.6 g L−1 potassium acetate (together 12 g carbon L−1), 11% carbon was found in biomass, 2% in L-alanine, 1% in L-valine, 1% in pyruvate and 31% NMeAla, while CO2 formation likely explains the fate of 55% of the carbon.

Thus, after balancing concentrations of the nitrogen and carbon sources for growth (ammonium sulfate, urea and acetate) with the substrates for production (glucose and MMA), NMeAla was produced by fermentation using C. glutamicum strain ELB-P(pVWEx1-dkpA) with a volumetric productivity of 0.15 g L−1 h−1 and a yield of 0.53 g g−1 glucose.

Fed-Batch bioreactor process of NMeAla production

To evaluate an enhancement of NMeAla production by feeding glucose and MMA a fed-batch cultivation in 4 L scale (initial volume) was performed. For higher cell density and higher production titers the fed-batch cultivation was performed with two independent feed phases (Fig. 4). The first feeding solution contained acetate and was coupled to the relative dissolved oxygen saturation (rDOS) signal with the intent to increase the biocatalyst concentration and to improve growth-associated production of NMeAla. The second feeding phase started after 22 h with an initial supply of 162 mL followed by a linear feed (12.3 mL h−1) of glucose and MMA (ratio 1:3) to boost growth-decoupled production of NMeAla. At the end of the fed-batch bioreactor process (98 h) 86.7 g acetate and 178.8 g glucose were consumed and the residual glucose concentration was 16.3 g L−1. A yield of 0.48 g NMeAla per g of acetate and glucose was achieved. Considering that growth of C. glutamicum NMeAla1 depends on acetate whereas production does not, a product yield on glucose was calculated to be 0.71 g g−1 glucose at a final titer of 31.7 g L−1 NMeAla and a volumetric productivity of 0.35 g L−1 h−1. The side-product l-alanine and the precursor pyruvate only accumulated to low concentrations (0.5 g L−1 and 2.1 g L−1, respectively). Thus, fermentative production of NMeAla in a fed-batch process resulted in enhanced final titer, volumetric productivity and yield in comparison to shake flask experiments.

Fed-batch cultivation with C. glutamicum NMeAla1 in minimal medium supplemented with potassium acetate and glucose as carbon and energy sources. A fermenter with an initial start volume of 4 L was used. First feed phase (potassium acetate) was coupled to the rDOS value. After 22 h the second feed phase was started by the initial addition of 162 mL of a glucose/MMA solution followed by a linear feed of 12.3 mL h−1. The biomass formation (black open squares), concentrations of NMeAla (red circles), l-alanine (blue squares), pyruvate (grey squares), acetate (green filled triangles) and glucose (green open triangles) were depicted. The volume of both feeds is shown as black lines. All depicted concentrations and the biomass formation was related to the initial volume.

Full size image

Establishing production of NMeAla from alternative feedstocks

Sustainable production from sugars that have competing uses in human and animal nutrition have to be succeeded by production processes based on second generation feedstocks such as lignocellulosic hydrolysates. Fermentative production of amino acids is typically based on glucose present in molasses or obtained from starch by hydrolysis. Direct utilization of starch as well as of the pentose sugars xylose and arabinose that can be obtained by hydrolysis of lignocellulosics required metabolic engineering of C. glutamicum41. Based on these strategies the C. glutamicum strains NMeAla1(pEXCT99A-amyA), NMeAla1(pEKEx3-xylAXc-xylBCg), and NMeAla1(pEXCT99A-araBAD) were constructed and tested for production of NMeAla from starch, arabinose and xylose, respectively. Upon expression of the α-amylase gene amyA from Streptomyces griseus, C. glutamicum can utilize starch42 and C. glutamicum strain NMeAla1(pEXCT99A-amyA) produced 7.5 ± 0.1 g L−1 NMeAla in minimal medium containing 30 g L−1 starch and 16.6 g L−1 potassium acetate (Fig. 5). Heterologous expression of the arabinose utilization operon araBAD from E. coli enables C. glutamicum to utilize arabinose as carbon and energy source43,44. C. glutamicum strain NMeAla1(pEXCT99A-araBAD) produced 4.2 ± 0.5 g L−1 NMeAla in minimal medium containing 30 g L−1 arabinose and 16.6 g L−1 potassium acetate (Fig. 5). Efficient utilization of the lignocellulose pentose sugar xylose was enabled by expression of the xylose isomerase gene xylA from Xanthomonas campestris combined with overexpression of the endogenous xylulokinase gene xylB45. In CGXII minimal medium containing 30 g L−1 xylose and 16.6 g L−1 potassium acetate, C. glutamicum strain NMeAla1(pEKEx3-xylAB) produced 7.0 ± 0.1 g L−1 of NMeAla (Fig. 5). Taken together, efficient production of NMeAla from three alternative feedstocks was shown.

Production of NMeAla from alternative carbon sources. The CGXII minimal medium with 16.6 g L−1 potassium acetate contained 30 g L−1 starch for cultivation production experiments using C. glutamicum strain NMeAla1(pECXT99A-amyA), 30 g L−1 arabinose using C. glutamicum strain NMeAla1(pECXT99A-araBAD) and 30 g L−1 xylose using C. glutamicum strain NMeAla1(pEKEx3-xylAB). Concentrations were determined after 72 h and are given as means with standard deviations of three replicates.

Full size image

Discussion

Fermentative access to the N-methylated amino acid NMeAla was achieved by introduction of the NMAADH gene dpkA from P. putida into the pyruvate overproducing C. glutamicum strain ELB-P. N-methyl-l-alanine titers of 31.7 g L−1 with a yield of 0.71 g per g glucose were achieved in fed-batch cultivation. The described C. glutamicum strains allow, to the best of our knowledge, the first fermentative production of NMeAla reported to date. Di-N-methyl-l-alanine, a frequent by-product in chemical methylation of l-alanine, was not observed. However, pyruvate and l-alanine accumulated as minor by-products.

l-Alanine was also a by-product of pyruvate31 and l-serine production46 although the genes alanine aminotransferase (alaT) and valine-pyruvate aminotransferase (avtA) have been deleted. Thus, at least one further l-alanine forming transaminase must be active in C. glutamicum.

Abolishing export of pyruvate and l-alanine was not possible since the export systems have not been identified. Deletion of export genes has been shown to be valuable to improve production of γ-aminobutyric acid (deletion of cgmA to abolish putrescine export)47, 5-aminovalerate and ectoine (deletion of lysine export gene lysE)48,49,50. As is the case for l-alanine, the export system for NMeAla is unknown. Given their similar structure it is conceivable that both l-alanine and NMeAla are exported by the same unknown export system. Alternatively, NMeAla may be substrate of the export system of C. glutamicum for branched-chain amino acids and l-methionine BrnEF51,52,53. The transcriptional regulator Lrp is activating transcription of brnFE at elevated intracellular concentrations of branched-chain amino acids and l-methionine54. Since N-methylation increases lipophilicity55,56, diffusion of the more lipophilic NMeAla across the cytoplasmic membrane of C. glutamicum is more relevant as compared to l-alanine. However, diffusion of amino acids across the cytoplasmic membranes of bacteria cannot explain transport processes against concentration gradients which require active transport systems. This not only holds true for charged amino acids such as l-lysine57, but also for uncharged amino acids such as l-isoleucine51,52. Future work will have to unravel the export systems of NMeAla, l-alanine and pyruvate in C. glutamicum.

In contrast, uptake of MMA into the C. glutamicum cell has been studied to some detail. The uncharged ammonia (NH3) is able to diffuse across the membrane, but its protonated form ammonium (NH4+) is actively imported by the transport proteins AmtA and AmtB58,59. Notably, as a probe for ammonium uptake, 14C-labelled MMA was used to determine uptake rates. Ammonium uptake in enteric bacteria such as E. coli operates by a comparable mechanism as shown for E. coli protein AmtB60.

The one-step process of NMeAla production will benefit from more efficient reductive N-methylamination of pyruvate by increasing the amount and/or the activity of NMAADH. Here, the NMAADH gene dpkA was cloned into the medium copy vector pVWEx1 and transcription initiated from the IPTG inducible promoter Ptrc and translation initiated from a standard ribosome binding site. Thus, as shown for expression of other genes in recombinant C. glutamicum, dpkA expression may benefit from the choice of the expression vector, the promoter and the ribosome binding site61,62,63,64.

Engineering of DpkA for more efficient reductive N-methylamination of pyruvate to yield NMeAla will also increase fermentative NMeAla production. The NMAADH DpkA used here for reductive N-methylamination of pyruvate has been shown to be part of the d-lysine degradation pathway in pseudomonads where it acts as imine reductase (IRED) reducing its native substrate piperideine-2-carboxylate18. IREDs that catalyze the asymmetric reduction of prochiral imines to chiral amines by using NAD(P)H as a hydride source are gaining increasing interest in bioorganic chemistry65,66,67,68. The substrate range is not restricted to cyclic imines and as shown for DpkA16,17,18, the (S)-selective IRED from Streptomyces sp. GF354669 and the (R)-selective IRED from Streptosporangium roseum70 also catalyze asymmetric reductive amination from suitable ketone and amine precursors. The latter reaction is expected to proceed via an imine either in solution or in the active site of the enzyme. Structure-function analysis of DkpA and other IREDs to improve asymmetric reductive amination from suitable ketone and amine precursors has not yet been described, but would be valuable to increase reductive N-methylamination of pyruvate to NMeAla by DkpA or derived variants. This approach has successfully been applied to the P450 oxidoreductase BM3 from B. megaterium71. By mutagenesis the enzyme was engineered to oxidize not only fatty acids72, but also N-alkanes73,74, the more sterically demanding β-ionone75, indole76,77 and others.

Here, we have developed a fermentative route to the N-methylated amino acid NMeAla. The biocatalytic route was based on N-methyl-l-amino acid dehydrogenase (NMAADH), which was integrated into the central metabolism of a pyruvate overproducing C. glutamicum strain. A final NMeAla titer of 31.7 g L−1 was achieved in fed-batch fermentation after balancing the ratio of the major substrates glucose and MMA. Additionally, NMeAla production from the alternative carbon sources xylose, arabinose and starch was enabled, thus, providing the basis for sustainable NMeAla production from second generation feedstocks.

Experimental

Bacterial strains and growth conditions

The strains and plasmids used in this study are listed in Table 1. E. coli DH5α78 was used for vector construction. C. glutamicum pre-cultures were grown in Lysogeny Broth (LB) medium containing 7 g L−1 sodium acetate in 500 mL baffled flask at 30 °C inoculated from a fresh LB agar plate. When necessary, the medium was supplemented with kanamycin (25 µg mL−1), spectromycin (100 µg mL−1) and/or tetracyclin (5 µg mL−1). The gene expression from the vectors pVWEx1, pEKEx3 and pECXT99A was induced by adding Isopropyl-β-D-1-thiogalactopyranoside (IPTG) (1 mm). For growth experiments or fermentative production of C. glutamicum cells were incubated in LB medium containing 7 g L−1 sodium acetate overnight on a rotary shaker, harvested (4000 × g, 7 min) and washed with TN buffer pH 6.3 (50 mm TrisHCl, 50 mm NaCl). The cells were inoculated to an optical density at 600 nm (OD600) of 1 in 50 mL CGXII minimal medium22 supplemented with 40 g L−1 glucose (wild type) or with blends of 20 or 30 g L−1 glucose, 16.6 g L−1 potassium acetate and 2 mm L-alanine (ELB-P). Growth in 500 mL baffled flasks was followed by measuring the OD600 using V-1200 Spectrophotometer (VWR, Radnor, PA, USA). The Biolector microfermentation system (m2p-labs, Aachen, Germany) was used for determination of the growth behavior in the presence of MMA or NMeAla and the carbon and nitrogen source growth tests. The shaking frequency was adjusted to 1200 rpm and 48-well flower plate wells with cultivation volumes of 1 mL were used and growth was followed by backscattered light at 620 nm and a signal gain factor of 20.

Full size table

Fed-Batch cultivation

Fermentation of C. glutamicum NMeAla1 was performed in an initial working volume of 4 L in a bioreactor (7 L NLF, Bioengineering AG, Switzerland) at 30 °C, 0.2 bar overpressure, and an aeration rate of 5 NL min−1. Stirrer speed was controlled to maintain relative dissolved oxygen saturation at 30% during growth phase. Due to controlled addition of KOH (4 m) and phosphoric acid (10% (w/w)) the pH was maintained at 7.0. To avoid foaming the antifoam Struktol® J647 was added manually when necessary. The first feeding phase with 26.7 g L−1 potassium acetate solution (total volume: 500 mL) was depending on the relative dissolved oxygen saturation, it was activated when the rDOS signal rose above 60% and stopped when rDOS felt below 60%. The second feeding phase (164 g L−1 glucose and 84 g L−1 MMA (total volume: 1000 mL)) was started manually after 22 h. Samples were taken automatically every 2 hours within the first 24 h and every 8 hours afterwards and cooled to 4 °C until analysis. For fermentation a modified CGXII minimal medium was used: 5 g L−1 (NH4)2SO4, 1.25 g L−1 urea, 1 g L−1 K2HPO4, 1 g L−1 KH2PO4, 5 g L−1 yeast extract in addition to the same concentrations of trace elements and vitamins as described elsewhere18. Modified CGXII was supplemented with 15 g L−1 KAc, 20 g L−1 glucose, 9.3 g L−1 MMA and 25 µg mL−1 kanamycin. The fermenter was inoculated by addition of 450 mL of a shake flask culture grown in the described media with extra 42 g L−1 MOPS buffer.

Molecular genetic techniques and strain construction

The standard molecular genetic techniques were performed as described in Grenn and Sambrook, 2012. Transformation of E. coli DH5α78 was performed by heat shock79, plasmid DNA transfer into C. glutamicum by electroporation22.The gene dpkA was amplified from P. putida KT2440 genomic DNA by using the primers dpkA-fw (GCCAAGCTTGCATGCCTGCAGAAAGGAGGCCCTTCAGATGTCCGCACCTTCCACCAG) and dpkA-rv (GGGATCCTCTAGAGTCGACCTGCATCAGCCAAGCAGCTCTTTCA); dpkA-fw carries the RBS sequence (italicized). For higher expression rates the start codon of dpkA was changed from GTG to ATG (underlined). The vector pVWEx1 was restricted with BamHI and incubated in a Gibson assembly80 with the PCR product for construction of plasmid pVWEx1-dpkA which was used to transform C. glutamicum strains. For construction of the expression plasmid harboring the genes for arabinose degradation araBAD from E. coli was amplified using genomic DNA of E. coli MG1655 with the primers araBAD-fw (CATGGAATTCGAGCTCGGTACCCGGGGAAAGGAGGCCCTTCAGATGGCGATTGCAATTGGCCT) and araBAD-rv (GCCTGCAGGTCGACTCTAGAGGATCTTACTGCCCGTAATATGCCT); araBAD-fw carries the RBS sequence (italicized). The vector pECXT99A was incubated with BamHI for restriction and incubated with the PCR product in an Gibson assembly80 for plasmid construction. The constructed plasmid was used to transform C. glutamicum strains.

Crude extract preparation and enzyme assays

Cells for crude extracts were inoculated as described above and harvested after 20 h and stored at −20 °C. From this step cell pellets and crude extract were handled at 4 °C or on ice. 150 to 200 mg cells were resuspended in 1 mL 100 mm glycine buffer (pH 10) and sonicated (UP 200 S, Dr. Hielscher GmbH, Teltow, Germany) at an amplitude of 60% and a duty cycle of 0.5 for 9 min. Protein concentration of the cell free extracts obtained by centrifugation (20200 × g, 30 min, 4 °C) was determined by the Bradford method81 with bovine serum albumin as reference.

For determination of the reductive N-methylamination activity the assay was performed as described18. In a total volume of 1 mL containing 100 mm glycine buffer (pH 10), 60 mm MMA, 10 mm pyruvate and 0.3 mm NADPH the consumption of NADPH (epsilon = 6200 L mol−1 cm−1) was detected at 340 nm at 30 °C for 3 min. The assay was performed in at least triplicates.

Quantification of amino acids and organic acids

Extracellular amino acids and pyruvate were quantified by high-performance liquid chromatography (HPLC) (1200 series, Agilent Technologies Deutschland GmbH, Böblingen, Germany). The culture supernatants were collected and centrifuged (20200 × g, 15 min) for further analysis.

For the detection of NMeAla and l-alanine the samples were derivatised with 9-fluorenylmethyl chlorocarbonate (Fmoc-Cl) according to published methods82 with modifications39. l-proline was used as internal standard. The separation was carried out by a reversed phase HPLC using a pre-column (LiChrospher 100 RP8 EC-5 μ (40 mm × 4.6 mm), CS-Chromatographie Service GmbH, Langerwehe, Germany) and a main column (LiChrospher 100 RP8 EC-5 μ (125 mm × 4.6 mm), CS Chromatographie Service GmbH). The detection was performed with a fluorescence detector (FLD G1321A, 1200 series, Agilent Technologies) with the excitation and emission wavelength of 263 nm and 310 nm respectively.

Analysis of l-valine was performed by an automatic pre-column derivatization with ortho-phthaldialdehyde (OPA)83 and separated on a reversed phase HPLC using pre- and main column (LiChrospher 100 RP8 EC-5μ, 125 mm × 4.6 mm, CS Chromatographie Service GmbH) with l-asparagine as internal standard. Detection of the fluorescent derivatives was carried out with a fluorescence detector with an excitation wavelength of 230 nm and an emission wavelength of 450 nm. Concentrations exceeding 0.1 g L−1 were considered further.

Pyruvate, acetate and glucose concentrations were measured with an amino exchange column (Aminex, 300 mm × 8 mm, 10 μm particle size, 25 Å pore diameter, CS Chromatographie Service GmbH) under isocratic conditions for 17 min at 60 °C with 5 mm sulfuric acid and a flow rate of 0,8 mL min−1. The detection was carried out with a Diode Array Detector (DAD, 1200 series, Agilent Technologies) at 210 nm. Concentrations exceeding 0.5 g L−1 were considered further.

Transcriptome analysis using DNA microarrays

For the transcriptome analysis in the presence of MMA, C. glutamicum wild type cells were grown in minimal medium supplemented with 250 mm MMA or 125 mm ammonium sulfate to exponential growth phase and harvested at an OD600 of 4. The RNA was isolated and transcriptome analysis using whole genome microarrays were performed as described previously84.

Data availability

All data generated or analyzed during this study are included in this published article (and its Supplementary Information files).

References

  1. 1.

    Cartwright, R. A., Roberts, E. A. H. & Wood, D. J. Theanine, an amino-acid N-ethyl amide present in tea. J. Sci. Food Agric.5, 597–599 (1954).

    ArticleCAS Google Scholar

  2. 2.

    Sakato, Y. Studies on the Chemical Constituents of Tea. Journal of the agricultural chemical society of Japan23, 262–267 (1950).

    ArticleCAS Google Scholar

  3. 3.

    Chatterjee, J., Rechenmacher, F. & Kessler, H. N-methylation of peptides and proteins: an important element for modulating biological functions. Angewandte Chemie (International ed. in English)52, 254–269 (2013).

    ArticleCAS Google Scholar

  4. 4.

    Miller, S. M. et al. Comparison of the proteolytic susceptibilities of homologous l-amino acid, d-amino acid, and N-substituted glycine peptide and peptoid oligomers. Drug Dev. Res.35, 20–32 (1995).

    ADSArticleCAS Google Scholar

  5. 5.

    Ostresh, J. M. et al. “Libraries from libraries”: chemical transformation of combinatorial libraries to extend the range and repertoire of chemical diversity. Proceedings of the National Academy of Sciences of the United States of America91, 11138–11142 (1994).

    ADSArticlePubMedPubMed Central Google Scholar

  6. 6.

    Turker, R. K., Hall, M. M., Yamamoto, M., Sweet, C. S. & Bumpus, F. M. A new, long-lasting competitive inhibitor of Angiotensin. Science177, 1203–1205 (1972).

    ADSArticlePubMedCAS Google Scholar

  7. 7.

    Dutt Konar, A. et al. Conformational properties of secondary amino acids: replacement of pipecolic acid by N-methyl-l-alanine in efrapeptin C. Chemistry & biodiversity10, 942–951 (2013).

    ArticleCAS Google Scholar

  8. 8.

    Chen, Y. et al. Glutamylmethylamide is an essential intermediate in the metabolism of methylamine by Methylocella silvestris. Applied and environmental microbiology76, 4530–4537 (2010).

    ArticlePubMedCASPubMed Central Google Scholar

  9. 9.

    Gruffaz, C. et al. Genes of the N-methylglutamate pathway are essential for growth of Methylobacterium extorquens DM4 with monomethylamine. Applied and environmental microbiology80, 3541–3550 (2014).

    ArticlePubMedCASPubMed Central Google Scholar

  10. 10.

    Latypova, E. et al. Genetics of the glutamate-mediated methylamine utilization pathway in the facultative methylotrophic beta-proteobacterium Methyloversatilis universalis FAM5. Molecular microbiology75, 426–439 (2010).

    ArticlePubMedCAS Google Scholar

  11. 11.

    Nayak, D. D. & Marx, C. J. Methylamine utilization via the N-methylglutamate pathway in Methylobacterium extorquens PA1 involves a novel flow of carbon through C1 assimilation and dissimilation pathways. Journal of bacteriology196, 4130–4139 (2014).

    ArticlePubMedCASPubMed Central Google Scholar

  12. 12.

    Kung, H.-F. & Wagner, C. The enzymatic synthesis of N-methylalanine. Biochimica et Biophysica Acta (BBA) - General Subjects201, 513–516 (1970).

    ArticleCAS Google Scholar

  13. 13.

    Lin, M. C. & Wagner, C. Purification and characterization of N-methylalanine dehydrogenase. The Journal of biological chemistry250, 3746–3751 (1975).

    PubMedCAS Google Scholar

  14. 14.

    Mangas-Sanchez, J. et al. Imine reductases (IREDs). Current opinion in chemical biology37, 19–25 (2017).

    ArticlePubMedCAS Google Scholar

  15. 15.

    Schrittwieser, J. H., Velikogne, S. & Kroutil, W. Biocatalytic imine reduction and reductive amination of ketones. Adv. Synth. Catal.357, 1655–1685 (2015).

    ArticleCAS Google Scholar

  16. 16.

    Mihara, H. et al. N-methyl-l-amino acid dehydrogenase from Pseudomonas putida. A novel member of an unusual NAD(P)-dependent oxidoreductase superfamily. The FEBS journal272, 1117–1123 (2005).

    ArticlePubMedCAS Google Scholar

  17. 17.

    Muramatsu, H. et al. Enzymatic synthesis of N-methyl-l-phenylalanine by a novel enzyme, N-methyl-l-amino acid dehydrogenase, from Pseudomonas putida. Tetrahedron: Asymmetry15, 2841–2843 (2004).

    ArticleCAS Google Scholar

  18. 18.

    Muramatsu, H. et al. The putative malate/lactate dehydrogenase from Pseudomonas putida is an NADPH-dependent Δ1-piperideine-2-carboxylate/ Δ1-pyrroline-2-carboxylate reductase involved in the catabolism of d-lysine and d -proline. The Journal of biological chemistry280, 5329–5335 (2005).

    ArticlePubMedCAS Google Scholar

  19. 19.

    Goto, M. et al. Crystal structures of Δ1-piperideine-2-carboxylate/Δ1-pyrroline-2-carboxylate reductase belonging to a new family of NAD(P)H-dependent oxidoreductases: conformational change, substrate recognition, and stereochemistry of the reaction. The Journal of biological chemistry280, 40875–40884 (2005).

    ArticlePubMedCAS Google Scholar

  20. 20.

    Aurelio, L., Brownlee, R. T. C. & Hughes, A. B. Synthetic preparation of N-methyl-alpha-amino acids. Chemical reviews104, 5823–5846 (2004).

    ArticlePubMedCAS Google Scholar

  21. 21.

    Lee, J.-H. & Wendisch, V. F. Biotechnological production of aromatic compounds of the extended shikimate pathway from renewable biomass. Journal of biotechnology257, 211–221 (2017).

    ArticlePubMedCAS Google Scholar

  22. 22.

    Eggeling, L. & Bott, M. Handbook of Corynebacterium glutamicum (Taylor & Francis, Boca Raton, 2005).

  23. 23.

    H. Yukawa & M. Inui eds. Corynebacterium glutamicum (Springer Berlin Heidelberg, Berlin, Heidelberg, 2013).

  24. 24.

    Shimizu, H. & Hirasawa, T. In Amino Acid Biosynthesis ~ Pathways, Regulation and Metabolic Engineering, edited by Wendisch, V. F., pp. 1–38. (Springer Berlin Heidelberg, Berlin, Heidelberg, 2007).

  25. 25.

    Wendisch, V. F. In Industrial Biotechnology, edited by Wittmann, C. & Liao, J. C., pp. 361–390 (Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim, Germany, 2017).

  26. 26.

    Becker, J. & Wittmann, C. Advanced biotechnology: metabolically engineered cells for the bio-based production of chemicals and fuels, materials, and health-care products. Angewandte Chemie (International ed. in English)54, 3328–3350 (2015).

    ArticleCAS Google Scholar

  27. 27.

    Heider, S. A. E. & Wendisch, V. F. Engineering microbial cell factories: Metabolic engineering of Corynebacterium glutamicum with a focus on non-natural products. Biotechnology journal10, 1170–1184 (2015).

    ArticlePubMedCAS Google Scholar

  28. 28.

    Bückle-Vallant, V., Krause, F. S., Messerschmidt, S. & Eikmanns, B. J. Metabolic engineering of Corynebacterium glutamicum for 2-ketoisocaproate production. Applied microbiology and biotechnology98, 297–311 (2014).

    ArticlePubMedCAS Google Scholar

  29. 29.

    Krause, F. S., Blombach, B. & Eikmanns, B. J. Metabolic engineering of Corynebacterium glutamicum for 2-ketoisovalerate production. Applied and environmental microbiology76, 8053–8061 (2010).

    ArticlePubMedCASPubMed Central Google Scholar

  30. 30.

    Wendisch, V. F. Microbial production of amino acid-related compounds. Advances in biochemical engineering/biotechnology159, 255–269 (2017).

    ArticlePubMedCAS Google Scholar

  31. 31.

    Wieschalka, S., Blombach, B. & Eikmanns, B. J. Engineering Corynebacterium glutamicum for the production of pyruvate. Applied microbiology and biotechnology94, 449–459 (2012).

    ArticlePubMedCAS Google Scholar

  32. 32.

    Schreiner, M. E., Fiur, D., Holátko, J., Pátek, M. & Eikmanns, B. J. E1 enzyme of the pyruvate dehydrogenase complex in Corynebacterium glutamicum: molecular analysis of the gene and phylogenetic aspects. Journal of bacteriology187, 6005–6018 (2005).

    ArticlePubMedCASPubMed Central Google Scholar

  33. 33.

    Blombach, B. et al. l-valine production with pyruvate dehydrogenase complex-deficient Corynebacterium glutamicum. Applied and environmental microbiology73, 2079–2084 (2007).

    ArticlePubMedCASPubMed Central Google Scholar

  34. 34.

    Schreiner, M. E., Riedel, C., Holátko, J., Pátek, M. & Eikmanns, B. J. Pyruvate:quinone oxidoreductase in Corynebacterium glutamicum: molecular analysis of the pqo gene, significance of the enzyme, and phylogenetic aspects. Journal of bacteriology188, 1341–1350 (2006).

    ArticlePubMedCASPubMed Central Google Scholar

  35. 35.

    Blombach, B. et al. Corynebacterium glutamicum tailored for efficient isobutanol production. Applied and environmental microbiology77, 3300–3310 (2011).

    ArticlePubMedCASPubMed Central Google Scholar

  36. 36.

    Blombach, B., Hans, S., Bathe, B. & Eikmanns, B. J. Acetohydroxyacid synthase, a novel target for improvement of l-lysine production by Corynebacterium glutamicum. Applied and environmental microbiology75, 419–427 (2009).

    ArticlePubMedCAS Google Scholar

  37. 37.

    Marienhagen, J., Kennerknecht, N., Sahm, H. & Eggeling, L. Functional analysis of all aminotransferase proteins inferred from the genome sequence of Corynebacterium glutamicum. Journal of bacteriology187, 7639–7646 (2005).

    ArticlePubMedCASPubMed Central Google Scholar

  38. 38.

    Wieschalka, S., Blombach, B., Bott, M. & Eikmanns, B. J. Bio-based production of organic acids with Corynebacterium glutamicum. Microbial biotechnology6, 87–102 (2013).

    ArticlePubMedCAS Google Scholar

  39. 39.

    Jensen, J. V. K. & Wendisch, V. F. Ornithine cyclodeaminase-based proline production by Corynebacterium glutamicum. Microbial cell factories12, 63 (2013).

    ArticlePubMedCASPubMed Central Google Scholar

  40. 40.

    Jorge, J. M. P., Leggewie, C. & Wendisch, V. F. A new metabolic route for the production of gamma-aminobutyric acid by Corynebacterium glutamicum from glucose. Amino acids48, 2519–2531 (2016).

    ArticlePubMedCAS Google Scholar

  41. 41.

    Goodfellow, M. et al. Bergey’s Manual of Systematic Bacteriology. Volume Five The Actinobacteria, Part A and B (Springer New York; Imprint: Springer, New York, NY, 2012).

  42. 42.

    Seibold, G., Auchter, M., Berens, S., Kalinowski, J. & Eikmanns, B. J. Utilization of soluble starch by a recombinant Corynebacterium glutamicum strain: growth and lysine production. Journal of biotechnology124, 381–391 (2006).

    ArticlePubMedCAS Google Scholar

  43. 43.

    Kawaguchi, H., Sasaki, M., Vertès, A. A., Inui, M. & Yukawa, H. Engineering of an l-arabinose metabolic pathway in Corynebacterium glutamicum. Applied microbiology and biotechnology77, 1053–1062 (2008).

    ArticlePubMedCAS Google Scholar

  44. 44.

    Schneider, J., Niermann, K. & Wendisch, V. F. Production of the amino acids l-glutamate, l -lysine, l -ornithine and l -arginine from arabinose by recombinant Corynebacterium glutamicum. Journal of biotechnology154, 191–198 (2011).

    ArticlePubMedCAS Google Scholar

  45. 45.

    Meiswinkel, T. M., Gopinath, V., Lindner, S. N., Nampoothiri, K. M. & Wendisch, V. F. Accelerated pentose utilization by Corynebacterium glutamicum for accelerated production of lysine, glutamate, ornithine and putrescine. Microbial biotechnology6, 131–140 (2013).

    ArticlePubMedCAS Google Scholar

  46. 46.

    Zhu, Q. et al. l-Serine overproduction with minimization of by-product synthesis by engineered Corynebacterium glutamicum. Applied microbiology and biotechnology99, 1665–1673 (2015).

    ArticlePubMedCAS Google Scholar

  47. 47.

    Jorge, J. M. P., Nguyen, A. Q. D., Pérez-García, F., Kind, S. & Wendisch, V. F. Improved fermentative production of gamma-aminobutyric acid via the putrescine route: Systems metabolic engineering for production from glucose, amino sugars, and xylose. Biotechnology and bioengineering114, 862–873 (2017).

    ArticlePubMedCAS Google Scholar

  48. 48.

    Rohles, C. M., Gießelmann, G., Kohlstedt, M., Wittmann, C. & Becker, J. Systems metabolic engineering of Corynebacterium glutamicum for the production of the carbon-5 platform chemicals 5-aminovalerate and glutarate. Microbial cell factories15, 154 (2016).

    ArticlePubMedCASPubMed Central Google Scholar

  49. 49.

    Becker, J. et al. Systems metabolic engineering of Corynebacterium glutamicum for production of the chemical chaperone ectoine. Microbial cell factories12, 110 (2013).

    ArticlePubMedCASPubMed Central Google Scholar

  50. 50.

    Pérez-García, F., Ziert, C., Risse, J. M. & Wendisch, V. F. Improved fermentative production of the compatible solute ectoine by Corynebacterium glutamicum from glucose and alternative carbon sources. Journal of biotechnology258, 59–68 (2017).

    ArticlePubMedCAS Google Scholar

  51. 51.

    Ebbighausen, H., Weil, B. & Krmer, R. Transport of branched-chain amino acids in Corynebacterium glutamicum. Arch. Microbiol.151, 238–244 (1989).

    ArticlePubMedCAS Google Scholar

  52. 52.

    Kennerknecht, N. et al. Export of l-Isoleucine from Corynebacterium glutamicum: a two-gene-encoded member of a new translocator family. Journal of bacteriology184, 3947–3956 (2002).

    Article

Sours: https://www.nature.com/articles/s41598-018-31309-5

Protein methylation at the surface and buried deep: thinking outside the histone box

1. Katz JE, et al. Automated identification of putative methyltransferases from genomic open reading frames. Mol. Cell. Proteomics. 2003;2:525–540. [PubMed] [Google Scholar]

2. Petrossian TC, Clarke S. Bioinformatic identification of novel methyltransferases. Epigenomics. 2009;1:163–175.[PMC free article] [PubMed] [Google Scholar]

3. Wlodarski T, et al. Comprehensive structural and substrate specificity classification of the Saccharomyces cerevisiae methyltransferome. PLoS ONE. 2011[PMC free article] [PubMed] [Google Scholar]

4. Petrossian TC, Clarke SG. Uncovering the human methyltransferasome. Mol. Cell. Proteomics. 2011[PMC free article] [PubMed] [Google Scholar]

5. Schubert HL, et al. Many paths to methyltransfer: a chronicle of convergence. Trends Biochem. Sci. 2003;28:329–335.[PMC free article] [PubMed] [Google Scholar]

6. Del Rizzo PA, Trievel RC. Substrate and product specificities of SET domain methyltransferases. Epigenetics. 2011;6:1059–1067.[PMC free article] [PubMed] [Google Scholar]

7. Tkaczuk KL, et al. Structural and evolutionary bioinformatics of the SPOUT superfamily of methyltransferases. BMC Bioinformatics. 2007[PMC free article] [PubMed] [Google Scholar]

8. Young BD, et al. Identification of methylated proteins in the yeast small ribosomal subunit: A role for SPOUT methyltransferases in protein arginine methylation. Biochemistry. 2012;51:5091–5104.[PMC free article] [PubMed] [Google Scholar]

9. Richon VM, et al. Chemogenetic analysis of human protein methyltransferases. Chem. Biol. Drug Des. 2011;78:199–210. [PubMed] [Google Scholar]

10. Clarke SG, Tamanoi F, editors. The Enzymes Volume 24: Protein Methyltransferases. Amsterdam: Academic Press; 2006. pp. 3–570. [Google Scholar]

11. Walsh CT. Posttranslational Modifications of Proteins: Expanding Nature's Inventory. Englewood Colorado: Roberts and Company; 2006. Protein Methylation; pp. 121–149. [Google Scholar]

12. Webb KJ, et al. Identification of protein N-terminal methyltransferases in yeast and humans. Biochemistry. 2010;49:5225–5235.[PMC free article] [PubMed] [Google Scholar]

13. Tooley CE, et al. NRMT is an alpha-N-methyltransferase that methylates RCC1 and retinoblastoma protein. Nature. 2010;466:1125–1128.[PMC free article] [PubMed] [Google Scholar]

14. Webb KJ, et al. A novel 3-methylhistidine modification of yeast ribosomal protein Rpl3 is dependent upon the YIL110W methyltransferase. J. Biol. Chem. 2010;285:37598–37606.[PMC free article] [PubMed] [Google Scholar]

15. Zhang L, et al. Cysteine methylation disrupts ubiquitin-chain sensing in NF-κB activation. Nature. 2012;481:204–210. [PubMed] [Google Scholar]

16. Magnani R, et al. Calmodulin methyltransferase is an evolutionarily conserved enzyme that trimethylates Lys-115 in calmodulin. Nature Commun. 2010 [PubMed] [Google Scholar]

17. Nguyen AT, Zhang Y. The diverse functions of Dot1 and H3K79 methylation. Genes Develop. 2011;25:1345–1358.[PMC free article] [PubMed] [Google Scholar]

18. Webb KJ, et al. The ribosomal L1 protuberance in yeast is methylated on a lysine residue catalyzed by a seven-β-strand methyltransferase. J. Biol. Chem. 2011;286:18405–18413.[PMC free article] [PubMed] [Google Scholar]

19. Kernstock S, et al. Lysine methylation of VCP by a member of a novel protein methyltransferase family. Nature Commun. 2012 [PubMed] [Google Scholar]

20. Couture JR, et al. Structural origins for the product specificity of SET domain protein methyltransferases. Proc. Natl. Acad. Sci. U. S. A. 2008;105:20659–20664.[PMC free article] [PubMed] [Google Scholar]

21. Jenuwein T. The epigenetic magic of histone lysine methylation. FEBS J. 2006;273:3121–3135. [PubMed] [Google Scholar]

22. Bannister AJ, Kouzarides T. Regulation of chromatin by histone modifications. Cell Res. 2011;21:381–395.[PMC free article] [PubMed] [Google Scholar]

23. Greer EL, Shi Y. Histone methylation: a dynamic mark in health, disease and inheritance. Nature Rev. Genet. 2012;13:343–357.[PMC free article] [PubMed] [Google Scholar]

24. Black JC, et al. Histone lysine methylation dynamics; establishment, regulation, and biological impact. Mol. Cell. 2012;48:491–507.[PMC free article] [PubMed] [Google Scholar]

25. Webb KJ, et al. Identification of two SET domain proteins required for methylation of lysine residues in yeast ribosomal protein Rpl42ab. J. Biol. Chem. 2008;283:35561–35568.[PMC free article] [PubMed] [Google Scholar]

26. Klein RR, Houtz RL. Cloning and developmental expression of pea ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit N-methyltransferase. Plant Mol. Biol. 1995;27:249–261. [PubMed] [Google Scholar]

27. Houtz RL, et al. Co- and post-translational modifications in Rubisco: unanswered questions. J. Exp. Bot. 2008;59:1635–1645. [PubMed] [Google Scholar]

28. Allis CD, et al. New nomenclature for chromatin-modifying enzymes. Cell. 2007;131:633–636. [PubMed] [Google Scholar]

29. Porras-Yakushi TR, et al. A novel SET domain methyltransferase in yeast: Rkm2-dependent trimethylation of ribosomal protein L12ab at the N-terminus. J. Biol. Chem. 2006;281:35835–35845. [PubMed] [Google Scholar]

30. Lantham JA, et al. Chromatin signaling to kinetochores: Transregulation of Dam1 methylation by histone H2B ubiquitination. Cell. 2011;146:709–719.[PMC free article] [PubMed] [Google Scholar]

31. Fuchs SM, et al. RNA polymerase II carboxyl-terminal domain phosphorylation regulates protein stability of the Set2 methyltransferase and histone H3 di- and trimethylation at lysine 36. J. Biol. Chem. 2012;287:3249–3256.[PMC free article] [PubMed] [Google Scholar]

32. Green EM, et al. Methylation of H4 lysines 5, 8, and 12 by yeast Set5 calibrates chromatin stress responses. Nature Struct. Mol. Biol. 2012;19:361–363.[PMC free article] [PubMed] [Google Scholar]

33. Porras-Yakushi TR, et al. Yeast ribosomal/cytochrome c SET domain methyltransferase subfamily: Identification of Rpl23ab methylation sites and recognition motifs. J. Biol. Chem. 2007;283:12368–12376. [PubMed] [Google Scholar]

34. Lipson RS, et al. Two novel methyltransferases acting upon eukaryotic elongation factor 1A in Saccharomyces cerevisiae. Arch. Biochem. Biophys. 2010;500:137–143.[PMC free article] [PubMed] [Google Scholar]

35. Couttas TA, et al. Methylation of translation-associated proteins in Saccharomyces cerevisiae: Identification of methylated lysines and their methyltransferases. Proteomics. 2012;12:960–972. [PubMed] [Google Scholar]

36. Polevoda B, et al. Cytochrome c methyltransferase, Ctm1p, of yeast. J. Biol. Chem. 2000;275:20508–20513. [PubMed] [Google Scholar]

37. Huang J, Berger SL. The emerging field of dynamic lysine methylation of non-histone proteins. Curr. Opin. Genetics Develop. 2008;18:152–158. [PubMed] [Google Scholar]

38. Jackson CA, et al. Proteomic analysis of interactors for yeast protein arginine methyltransferase Hmt1 reveals novel substrate and insights into additional biological roles. Proteomics. 2012;12:3304–3314. [PubMed] [Google Scholar]

39. Chern MK, et al. Yeast ribosomal protein L12 is a substrate of protein-arginine methyltransferase 2. J. Biol. Chem. 2002;277:15343–15353. [PubMed] [Google Scholar]

40. Sayegh J, Clarke SG. Hsl7 is a substrate-specific type II protein arginine methyltransferase in yeast. Biochem. Biophys. Res. Commun. 2008;372:811–815.[PMC free article] [PubMed] [Google Scholar]

41. Polevoda B, et al. The yeast translation release factors Mrf1p and Sup45p (eRF1) are methylated, respectively, by the methyltransferases Mtq1p and Mtq2p. J. Biol. Chem. 2006;281:2562–2571. [PubMed] [Google Scholar]

42. Leulliott N, et al. Structure of protein phosphatase methyltransferase 1 (PPM1), a leucine carboxyl methyltransferase involved in the regulation of protein phosphatase 2A activity. J. Biol. Chem. 2004;279:8351–8358. [PubMed] [Google Scholar]

43. Hahne K, et al. Evaluation of substrate and inhibitor binding to yeast and human isoprenylcysteine carboxyl methyltransferases (Icmts) using biotinylated benzophenone-containing photoaffinity probes. Biochem. Biophys. Res. Commun. 2012;423:98–103.[PMC free article] [PubMed] [Google Scholar]

44. Polevoda B, Sherman F. Methylation of proteins involved in translation. Mol. Microbiol. 2007;65:590–606. [PubMed] [Google Scholar]

45. Ben-Shem A, et al. The structure of the eucaryotic ribosome at 3.0 Å resolution. Science. 2011;334:1524–1529. [PubMed] [Google Scholar]

46. Erce MA, et al. The methylproteome and the intracellular methylation network. Proteomics. 2012;12:564–586. [PubMed] [Google Scholar]

47. Horowitz S, Trievel RC. Carbon-oxygen hydrogen bonding in biological structure and function. J. Biol. Chem. 2012;287:41576–41582.[PMC free article] [PubMed] [Google Scholar]

48. Iwase S, et al. ATRX ADD domain links an atypical histone methylation recognition mechanism to human mental-retardation syndrome. Nature Struct. Mol. Biol. 2011;18:769–777.[PMC free article] [PubMed] [Google Scholar]

49. Lee JM, et al. EZH2 generates a methyl degron that is recognized by the DCAF1/DDB1/CUL4 E3 ubiquitin ligase complex. Mol. Cell. 2012;48:572–586. [PubMed] [Google Scholar]

50. He A, et al. PRC2 directly methylates GATA4 and represses its transcriptional activity. Genes Develop. 2012;26:37–42.[PMC free article] [PubMed] [Google Scholar]

51. Tate CM, et al. CXXC finger protein 1 restricts the Setd1a histone H3K4 methyltransferase complex to euchromatin. FEBS J. 2010;277:210–223.[PMC free article] [PubMed] [Google Scholar]

52. Cho HS, et al. Enhanced HSP70 lysine methylation promotes proliferation of cancer cells through activation of Aurora kinase B. Nature Commun. 2012[PMC free article] [PubMed] [Google Scholar]

53. Shinkai Y, Tachibana M. H3K9 methyltransferase G9a and the related molecule GLP. Genes Develop. 2011;25:781–788.[PMC free article] [PubMed] [Google Scholar]

54. Rathert P, et al. Protein lysine methyltransferase G9a acts on non-histone targets. Nature Chem. Biol. 2008;4:344–346.[PMC free article] [PubMed] [Google Scholar]

55. Huang J, et al. G9a and Glp methylate lysine 373 in the tumor suppressor p53. J. Biol. Chem. 2010;285:9636–9641.[PMC free article] [PubMed] [Google Scholar]

56. Ling BMT, et al. Lysine methyltransferase G9a methylates the transcription factor MyoD and regulates skeletal muscle differentiation. Proc. Natl. Acad. Sci. U. S. A. 2012;109:841–846.[PMC free article] [PubMed] [Google Scholar]

57. Pagans S, et al. Characterization of HIV Tat modifications using novel methyl-lysine-specific antibodies. Methods. 2010;53:91–96.[PMC free article] [PubMed] [Google Scholar]

58. Van Aller GS. Smyd3 regulates cancer cell phenotypes and catalyzes histone H4 lysine 5 methylation. Epigenetics. 2012;7:340–343.[PMC free article] [PubMed] [Google Scholar]

59. Kunizaki M, et al. The lysine 831 of vascular endothelial growth factor receptor 1 is a novel target of methylation by SMYD3. Cancer Res. 2007;67:10759–10765. [PubMed] [Google Scholar]

60. Binda A, et al. SETD6 monomethylates H2AZ on lysine 7 and is required for the maintenance of embryonic stem cell self-renewal. Epigenetics. 2013;8:1–7.[PMC free article] [PubMed] [Google Scholar]

61. Levy D, et al. Lysine methylation of the NF-kappaB subunit RelA by SETD6 couples activity of the histone methyltransferase GLP at chromatin to tonic repression of NF-kappaB signaling. Nature Immunol. 2011;12:29–36.[PMC free article] [PubMed] [Google Scholar]

62. Kudithipudi S, et al. The SET8 H4K20 protein lysine methyltransferase has a long recognition sequence covering seven amino acid residues. Biochimie. 2012;94:2212–2218. [PubMed] [Google Scholar]

63. Shi X, et al. Modulation of p53 function by SET8-mediated p53 methylation at lysine 382. Mol. Cell. 2007;27:636–646.[PMC free article] [PubMed] [Google Scholar]

64. Dhayalan A, et al. Specificity analysis-based identification of new methylation targets of the SET7/9 protein lysine methyltransferase. Chem. Biol. 2011;18:111–120. [PubMed] [Google Scholar]

65. Calnan DR, et al. Methylation by Set9 modulates FoxO3 stability and transcriptional activity. Aging. 2012;4:462–479.[PMC free article] [PubMed] [Google Scholar]

66. Ferguson AD, et al. Structural basis of substrate methylation and inhibition of SMYD2. Structure. 2011;19:1262–1273. [PubMed] [Google Scholar]

67. Abu-Farna, et al. Proteomic analyses of the SMYD family interactomes identify HSP90 as a novel target for SMYD2. J. Mol. Cell Biol. 2011;3:301–308. [PubMed] [Google Scholar]

68. Cho HS, et al. RB1 methylation by SMYD2 enhances cell cycle progression through an increase of RB1 phosphorylation. Neoplasia. 2012;14:476–486.[PMC free article] [PubMed] [Google Scholar]

69. Williamson NA, et al. Post-translational processing of rat ribosomal proteins: Ubiquitious methylation of Lys22 within the zinc-finger motif of RL40 (carboxyl-terminal extension protein 52) and tissue-specific methylation of Lys4 in RL29. Eur. J. Biochem. 1997;246:786–793. [PubMed] [Google Scholar]

70. Levy D, et al. A proteomic approach for the identification of novel lysine methyltransferase substrates. Epigenetics Chromatin. 2011[PMC free article] [PubMed] [Google Scholar]

71. Chu Y, et al. Identification and characterization of a highly conserved crenarchael protein lysine methyltransferase with broad substrate specificity. J. Bacteriol. 2012;194:6917–6926.[PMC free article] [PubMed] [Google Scholar]

72. Bedford MT, Clarke SG. Protein arginine methylation in mammals: Who, what, and why. Mol. Cell. 2009;33:1–13.[PMC free article] [PubMed] [Google Scholar]

73. Low JKK, Wilkins MR. Protein arginine methylation in Saccharomyces cerevisiae. FEBS J. 2012;279:4423–4443. [PubMed] [Google Scholar]

74. Yang Y, Bedford MT. Protein arginine methyltransferases and cancer. Nature Rev. Cancer. 2012;13:37–50. [PubMed] [Google Scholar]

75. Zurita-Lopez CI, et al. Human protein arginine methyltransferase 7 (PRMT7) is a type III enzyme forming ω-NG-monomethylated arginine residues. J. Biol. Chem. 2012;287:7859–7870.[PMC free article] [PubMed] [Google Scholar]

76. Lee J, et al. PRMT8, a new membrane-bound tissue-specific member of the protein arginine methyltransferase family. J. Biol. Chem. 2005;280:32890–32896. [PubMed] [Google Scholar]

77. Krause CD, et al. Protein arginine methyltransferases: Evolution and assessment of their pharmacological and therapeutic potential. Pharmacol. Therapeut. 2007;113:50–87. [PubMed] [Google Scholar]

78. Hermann, et al. Human protein arginine methyltransferases in vivo – distinct properties of eight canonical members of the PRMT family. J. Cell Sci. 2009;122:667–677. [PubMed] [Google Scholar]

79. Wu CC, et al. Organellar proteomics reveals Golgi arginine dimethylation. Mol. Biol. Cell. 2004;15:2907–2919. Correction Mol. Biol. Cell 15 (11) page 0. [PMC free article] [PubMed] [Google Scholar]

80. Nyman T, et al. The role of MeH73 in actin polymerization and ATP hydrolysis. J. Mol. Biol. 2002;317:577–589. [PubMed] [Google Scholar]

81. Meskauskas A, Dinman JD. A molecular clamp ensures allosteric coordination of peptidyltransfer and ligand binding to the ribosomal A-site. Nuc. Acids Res. 2010;38:7800–7813.[PMC free article] [PubMed] [Google Scholar]

82. Sedgwick B, et al. Repair of alkylated DNA: recent advances. DNA Repair. 2007;6:429–442. [PubMed] [Google Scholar]

83. Boal AK, et al. Structural basis for methyl transfer by a radical SAM enzyme. Science. 2011;332:1089–1092.[PMC free article] [PubMed] [Google Scholar]

84. Siddique AN, et al. Auto-methylation of the mouse DNA-(cytosine C5)-methyltransferase Dnmt3a at its active site cysteine residue. FEBS J. 2011;278:2055–2063. [PubMed] [Google Scholar]

85. Stock A, et al. N-terminal methylation of proteins: structure, function, and specificity. FEBS Lett. 1987;220:8–14. [PubMed] [Google Scholar]

86. Petkowski JJ, et al. Substrate specificity of mammalian N-terminal alpha-amino methyltransferase. Biochemistry. 2012;51:5942–5950.[PMC free article] [PubMed] [Google Scholar]

Sours: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3634909/
  1. Macconkey agar quizlet
  2. 1040 mailing instructions
  3. Arcgis open source
  4. Florida brightline train

Comprehending Dynamic Protein Methylation with Mass Spectrometry

1. Bedford MT, Clarke SG. Protein arginine methylation in mammals: who, what, and why. Mol Cell. 2009;33:1–13.[PMC free article] [PubMed] [Google Scholar]

2. Paik WK, Paik DC, Kim S. Historical review: the field of protein methylation. Trends Biochem Sci. 2007;32:146–152. [PubMed] [Google Scholar] **This review is an introduction to protein methylation, history of research and the functional impact of protein methylation.

3. Ishikawa Y, Melville DB. The enzymatic alpha-N-methylation of histidine. J Biol Chem. 1970;245:5967–5973. [PubMed] [Google Scholar]

4. Lee YH, Stallcup MR. Minireview: Protein arginine methylation of nonhistone proteins in transcriptional regulation. Mol Endocrinol. 2009;23:425–433.[PMC free article] [PubMed] [Google Scholar]

5. Zee BM, Levin RS, Xu B, LeRoy G, Wingreen NS, Garcia BA. In vivo residuespecific histone methylation dynamics. J Biol Chem. 2010;285:3341–3350.[PMC free article] [PubMed] [Google Scholar]

6. Erce MA, Pang CN, Hart-Smith G, Wilkins MR. The methylproteome and the intracellular methylation network. Proteomics. 2012;12:564–586. [PubMed] [Google Scholar] *In this review, analytical techniques to detect and localize methylation sites are discussed. In addition, methylation, interactome, cross-talks are reviewed.

7. Zhao Y, Jensen ON. Modification-specific proteomics: strategies for characterization of post-translational modifications using enrichment techniques. Proteomics. 2009;9:4632–4641.[PMC free article] [PubMed] [Google Scholar]

8. Choudhary C, Mann M. Decoding signaling networks by mass spectrometrybased proteomics. Nat Rev Mol Cell Biol. 2010;11:427–439. [PubMed] [Google Scholar]

9. Jensen ON. Interpreting the protein language using proteomics. Nat Rev Mol Cell Biol. 2006;7:391–403. [PubMed] [Google Scholar] **This review discuss challenges in PTM analysis, PTM analysis by mass spectrometry and modification-specific proteomics including enrichment strategies. Further, new technologies and integrative computational stretegies are reviewed.

10. Walsh CT, Garneau-Tsodikova S, Gatto GJ Jr. Protein posttranslational modifications: the chemistry of proteome diversifications. Angew Chem Int Ed Engl. 2005;44:7342–7372. [PubMed] [Google Scholar] * This review is about the chemical mechanism of protein post-translational modification, covering almost all types of modifications.

11. Zhang K, Yau PM, Chandrasekhar B, New R, Kondrat R, Imai BS, Bradbury ME. Differentiation between peptides containing acetylated or tri-methylated lysines by mass spectrometry: an application for determining lysine 9 acetylation and methylation of histone H3. Proteomics. 2004;4:1–10. [PubMed] [Google Scholar]

12. Garcia BA. What does the future hold for Top Down mass spectrometry? J Am Soc Mass Spectrom. 2010;21:193–202. [PubMed] [Google Scholar] **A comprehensive technical review on Top-down mass spectrometry. Instrumentation, data analysis software and separation methods for Top-down are discussed. A comparison to other methods, including middle-down and bottom-up, is made.

13. Thomas CE, Kelleher NL, Mizzen CA. Mass spectrometric characterization of human histone H3: a bird's eye view. J Proteome Res. 2006;5:240–247. [PubMed] [Google Scholar]

14. Tran JC, Zamdborg L, Ahlf DR, Lee JE, Catherman AD, Durbin KR, Tipton JD, Vellaichamy A, Kellie JF, Li M, Wu C, Sweet SM, Early BP, Siuti N, LeDuc RD, Compton PD, Thomas PM, Kelleher NL. Mapping intact protein isoforms in discovery mode using top-down proteomics. Nature. 2011;480:254–258.[PMC free article] [PubMed] [Google Scholar]

15. Plazas-Mayorca MD, Bloom JS, Zeissler U, Leroy G, Young NL, DiMaggio PA, Krugylak L, Schneider R, Garcia BA. Quantitative proteomics reveals direct and indirect alterations in the histone code following methyltransferase knockdown. Mol Biosyst. 2010;6:1719–1729.[PMC free article] [PubMed] [Google Scholar]

16. Cannon J, Lohnes K, Wynne C, Wang Y, Edwards N, Fenselau C. High-throughput middle-down analysis using an orbitrap. J Proteome Res. 2010;9:3886–3890.[PMC free article] [PubMed] [Google Scholar]

17. Young NL, DiMaggio PA, Plazas-Mayorca MD, Baliban RC, Floudas CA, Garcia BA. High throughput characterization of combinatorial histone codes. Mol Cell Proteomics. 2009;8:2266–2284.[PMC free article] [PubMed] [Google Scholar]

18. Garcia BA, Pesavento JJ, Mizzen CA, Kelleher NL. Pervasive combinatorial modification of histone H3 in human cells. Nat Methods. 2007;4:487–489. [PubMed] [Google Scholar]

19. Macek B, Waanders LF, Olsen JV, Mann M. Top-down protein sequencing and MS3 on a hybrid linear quadrupole ion trap-orbitrap mass spectrometer. Mol Cell Proteomics. 2006;5:949–958. [PubMed] [Google Scholar]

20. Kelleher NL, Zubarev RA, Bush K, Furie B, Furie BC, McLafferty FW, Walsh CT. Localization of labile posttranslational modifications by electron capture dissociation: the case of gamma-carboxyglutamic acid. Anal Chem. 1999;71:4250–4253. [PubMed] [Google Scholar]

21. Syka JE, Coon JJ, Schroeder MJ, Shabanowitz J, Hunt DF. Peptide and protein sequence analysis by electron transfer dissociation mass spectrometry. Proc Natl Acad Sci U S A. 2004;101:9528–9533.[PMC free article] [PubMed] [Google Scholar] ** First paper on ETD fragmentation mechanism and development. They used gas-phase ion-ion chemistry and MS/MS to analyze peptide sequence and to induce backbone fragmentation. This fragmentation (ETD) is done by transfer of singly charged anthracene anions to multiply protonated peptides. They used ETD to analyse phospho-peptides by MS/MS using a quadrupole-linear-trap.

22. Sidoli S, Cheng L, Jensen ON. Proteomics in chromatin biology and epigenetics: Elucidation of post-translational modifications of histone proteins by mass spectrometry. J Proteomics. 2012;75:3419–3433. [PubMed] [Google Scholar] * This review focuses on histone PTMs. The separation of histone variants, enrichment methods, and mass spectrometry analysis for histone analysis as well as quantitation are discussed. Further, Chromatin-IP and Mass spectrometry analysis as well as data handling are reviewed.

23. Wu T, Yuan T, Tsai SN, Wang C, Sun SM, Lam HM, Ngai SM. Mass spectrometry analysis of the variants of histone H3 and H4 of soybean and their posttranslational modifications. BMC Plant Biol. 2009;9:98.[PMC free article] [PubMed] [Google Scholar]

24. Garcia BA, Thomas CE, Kelleher NL, Mizzen CA. Tissue-specific expression and post-translational modification of histone H3 variants. J Proteome Res. 2008;7:4225–4236.[PMC free article] [PubMed] [Google Scholar]

25. Ong SE, Mittler G, Mann M. Identifying and quantifying in vivo methylation sites by heavy methyl SILAC. Nat Methods. 2004;1:119–126. [PubMed] [Google Scholar] ** This study describes the methyl-SILAC method, which allows for studying invivo methylation sites with direct methyl-group labeling. This method allows confident identification and relative quantitation of protein methylation by mass spectrometry.

26. Iwabata H, Yoshida M, Komatsu Y. Proteomic analysis of organ-specific post-translational lysine-acetylation and -methylation in mice by use of anti-acetyllysine and -methyllysine mouse monoclonal antibodies. Proteomics. 2005;5:4653–4664. [PubMed] [Google Scholar]

27. Boisvert FM, Lam YW, Lamont D, Lamond AI. A quantitative proteomics analysis of subcellular proteome localization and changes induced by DNA damage. Mol Cell Proteomics. 2010;9:457–470.[PMC free article] [PubMed] [Google Scholar]

28. Uhlmann T, Geoghegan VL, Thomas B, Ridlova G, Trudgian DC, Acuto O. A method for large-scale identification of protein arginine methylation. Mol Cell Proteomics. 2012[PMC free article] [PubMed] [Google Scholar] * They used multi-dimensional chromatography in combination with a methylarginine antibody to enrich methylated arginines from a complex mixture. Methylation sites were identified using HCD fragmentation on a Q-Exactive instrument.

29. Gehrig PM, Hunziker PE, Zahariev S, Pongor S. Fragmentation pathways of N(G)- methylated and unmodified arginine residues in peptides studied by ESIMS/ MS and MALDI-MS. J Am Soc Mass Spectrom. 2004;15:142–149. [PubMed] [Google Scholar]

30. Brame CJ, Moran MF, McBroom-Cerajewski LD. A mass spectrometry based method for distinguishing between symmetrically and asymmetrically dimethylated arginine residues. Rapid Commun Mass Spectrom. 2004;18:877–881. [PubMed] [Google Scholar]

31. Wang H, Straubinger RM, Aletta JM, Cao J, Duan X, Yu H, Qu J. Accurate localization and relative quantification of arginine methylation using nanoflow liquid chromatography coupled to electron transfer dissociation and orbitrap mass spectrometry. J Am Soc Mass Spectrom. 2009;20:507–519.[PMC free article] [PubMed] [Google Scholar] ** They used an alternating CID/ETD method to localize and characterize arginine methylation in proteins with arginine-rich motifs.

32. Snijders AP, Hung ML, Wilson SA, Dickman MJ. Analysis of arginine and lysine methylation utilizing peptide separations at neutral pH and electron transfer dissociation mass spectrometry. J Am Soc Mass Spectrom. 2010;21:88–96. [PubMed] [Google Scholar] ** An ETD fragmentation method was used to identify and characterize methylated peptides. The researchers identified diagnostic ions in ETD spectra for methylated arginine.

33. Hart-Smith G, Low JK, Erce MA, Wilkins MR. Enhanced methylarginine characterization by post-translational modification-specific targeted data acquisition and electron-transfer dissociation mass spectrometry. J Am Soc Mass Spectrom. 2012;23:1376–1389. [PubMed] [Google Scholar] ** The authors used targeted data acquisition to study methyl-arginine by ETD fragmentation. They determined that ETD is the preferred fragmentation method for the characterization of methyl-arginine.

34. Rappsilber J, Friesen WJ, Paushkin S, Dreyfuss G, Mann M. Detection of arginine dimethylated peptides by parallel precursor ion scanning mass spectrometry in positive ion mode. Anal Chem. 2003;75:3107–3114. [PubMed] [Google Scholar]

35. Hirota J, Satomi Y, Yoshikawa K, Takao T. Epsilon -N,N,N-trimethyllysine-specific ions in matrix-assisted laser desorption/ionization-tandem mass spectrometry. Rapid Commun Mass Spectrom. 2003;17:371–376. [PubMed] [Google Scholar]

36. Couttas TA, Raftery MJ, Bernardini G, Wilkins MR. Immonium ion scanning for the discovery of post-translational modifications and its application to histones. J Proteome Res. 2008;7:2632–1641. [PubMed] [Google Scholar]

37. Schroeder MJ, Shabanowitz J, Schwartz JC, Hunt DF, Coon JJ. A neutral loss activation method for improved phosphopeptide sequence analysis by quadrupole ion trap mass spectrometry. Anal Chem. 2004;76:3590–3598. [PubMed] [Google Scholar]

38. Cox J, Mann M. Quantitative, high-resolution proteomics for data-driven systems biology. Annu Rev Biochem. 2011;80:273–299. [PubMed] [Google Scholar] ** A comprehensive review on large-scale protein analysis and quantitative proteomics.

39. Picotti P, Aebersold R. Selected reaction monitoring-based proteomics: workflows, potential, pitfalls and future directions. Nat Methods. 2012;9:555–566. [PubMed] [Google Scholar] ** In this review selected reaction monitoring method development and other quantitation techniques are discussed. In addition, SRM’s application to proteomics, to PTMs and clinical applications are reviewed. Further, the pitfalls and outlooks for SRM approaches are discussed.

40. Peterson AC, Russell JD, Bailey DJ, Westphall MS, Coon JJ. Parallel reaction monitoring for high resolution and high mass accuracy quantitative, targeted proteomics. Mol Cell Proteomics. 2012[PMC free article] [PubMed] [Google Scholar] ** The authors introduced the new quantitative targeted method:"PRM”, an adaption of the SRM method for the Q-exactive instrument with applications for proteomics.

41. Garcia BA. Mass spectrometric analysis of histone variants and post-translational modifications. Front Biosci. 2009;1:142–153. [PubMed] [Google Scholar]

42. Pesavento JJ, Bullock CR, LeDuc RD, Mizzen CA, Kelleher NL. Combinatorial modification of human histone H4 quantitated by two-dimensional liquid chromatography coupled with top down mass spectrometry. J Biol Chem. 2008;283:14927–14937.[PMC free article] [PubMed] [Google Scholar]

43. Phanstiel D, Brumbaugh J, Berggren WT, Conard K, Feng X, Levenstein ME,McAlister GC, Thomson JA, Coon JJ. Mass spectrometry identifies and quantifies 74 unique histone H4 isoforms in differentiating human embryonic stem cells. Proc Natl Acad Sci U S A. 2008;105:4093–4098.[PMC free article] [PubMed] [Google Scholar]

44. Smith CM, Gafken PR, Zhang Z, Gottschling DE, Smith JB, Smith DL. Massspectrometric quantification of acetylation at specific lysines within the amino-terminal tail of histone H4. Anal Biochem. 2003;316:23–33. [PubMed] [Google Scholar]

45. Garcia BA, Mollah S, Ueberheide BM, Busby SA, Muratore TL, Shabanowitz J, Hunt DF. Chemical derivatization of histones for facilitated analysis by mass spectrometry. Nat Protoc. 2007;2:933–938.[PMC free article] [PubMed] [Google Scholar] ** A method paper on double-chemical derivatization using propionic anhydride to mimic reproducible Arg-C digests. They combined the method with stable isotope labeling to characterize and quantify histone modifications.

46. Plazas-Mayorca MD, Zee BM, Young NL, Finger man IM, LeRoy G, Briggs SD, Garcia BA. One-pot shotgun quantitative mass spectrometry characterization of histones. J Proteome Res. 2009;8:5367–5374.[PMC free article] [PubMed] [Google Scholar]

47. Blair LP, Avert NL, Huang R, Cole PA, Tavern SD, Tackett AJ. MassSQUIRM: An assay for quantitative measurement of lysine demethylase activity. Epigenetics. 2011;6:490–499.[PMC free article] [PubMed] [Google Scholar]

48. Darwanto A, Curtis MP, Schrage M, Kirsch W, Liu P, Xu G, Neigh JW, Zhang K. A modified "cross-talk" between histone H2B Lys-120 ubiquitination and H3 Lys-79 methylation. J Biol Chem. 2010;285:21868–21876.[PMC free article] [PubMed] [Google Scholar] * One of the very few MRM studies on histone modifications and cross-talk events. Twenty different modified sites in histones were quantified by MS. The authors showed inverse correlation of H2B ubiquitination and H3 Lys-79 methylation.

49. Savitski MM, Nielsen ML, Zubarev RA. ModifiComb, a new proteomic tool for mapping sub-stoichiometric post-translational modifications, finding novel types of modifications, and fingerprinting complex protein mixtures. Mol Cell Proteomics. 2006;5:935–948. [PubMed] [Google Scholar]

50. Jung SY, Li Y, Wang Y, Chen Y, Zhao Y, Qin J. Complications in the assignment of 14 and 28 Da mass shift detected by mass spectrometry as in vivo methylation from endogenous proteins. Anal Chem. 2008;80:1721–1729.[PMC free article] [PubMed] [Google Scholar] * The assignment of 14 or 28 Da mass shifts identified by MS as a result of methylation, is complicated. A large number of peptides can be modified on lysine, arginine, histidine, and glutamic acid residues with a mass increase of 14 or 18. Using Methyl-SILAC method, they described that technical methylation (gel-based method) can cause complications in correctly of endogenous methylation.

Sours: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4055027/

Protein methylation

Protein methylation is a type of post-translational modification featuring the addition of methyl groups to proteins. It can occur on the nitrogen-containing side-chains of arginine and lysine,[1][2] but also at the amino- and carboxy-termini of a number of different proteins. In biology, methyltransferases catalyze the methylation process, activated primarily by S-adenosylmethionine. Protein methylation has been most studied in histones, where the transfer of methyl groups from S-adenosyl methionine is catalyzed by histone methyltransferases. Histones that are methylated on certain residues can act epigenetically to repress or activate gene expression.[3][4]

Methylation by substrate[edit]

Multiple sites of proteins can be methylated. For some types of methylation, such as N-terminal methylation and prenylcysteine methylation, additional processing is required, whereas other types of methylation such as arginine methylation and lysine methylation do not require pre-processing.

Arginine[edit]

Arginine methylation by type I and II PRMTs.

Arginine can be methylated once (monomethylated arginine) or twice (dimethylated arginine). Methylation of arginine residues is catalyzed by three different classes of protein arginine methyltransferases (PRMTs): Type I PRMTs (PRMT1, PRMT2, PRMT3, PRMT4, PRMT6, and PRMT8) attach two methyl groups to a single terminal nitrogen atom, producing asymmetric dimethylarginine (N G,N G-dimethylarginine). In contrast, type II PRMTs (PRMT5 and PRMT9) catalyze the formation of symmetric dimethylarginine with one methyl group on each terminal nitrogen (symmetric N G,N' G-dimethylarginine). Type I and II PRMTs both generate N G-monomethylarginine intermediates; PRMT7, the only known type III PRMT, produces only monomethylated arginine. [5]

Arginine-methylation usually occurs at glycine and arginine-rich regions referred to as "GAR motifs",[6] which is likely due to the enhanced flexibility of these regions that enables insertion of arginine into the PRMT active site. Nevertheless, PRMTs with non-GAR consensus sequences exist.[5] PRMTs are present in the nucleus as well as in the cytoplasm. In interactions of proteins with nucleic acids, arginine residues are important hydrogen bond donors for the phosphate backbone — many arginine-methylated proteins have been found to interact with DNA or RNA.[6][7]

Enzymes that facilitate histone acetylation[citation needed] as well as histones themselves can be arginine methylated. Arginine methylation affects the interactions between proteins and has been implicated in a variety of cellular processes, including protein trafficking, signal transduction and transcriptional regulation.[6] In epigenetics, arginine methylation of histones H3 and H4 is associated with a more accessible chromatin structure and thus higher levels of transcription. The existence of arginine demethylases that could reverse arginine methylation is controversial.[5]

Lysine[edit]

Lysine methylation by PKMTs and demethylation by PKDMs.

Lysine can be methylated once, twice, or three times by lysine methyltransferases (PKMTs).[8] Most lysine methyltransferases contain an evolutionarily conserved SET domain, which possesses S-adenosylmethionine-dependent methyltransferase activity, but are structurally distinct from other S-adenosylmethionine binding proteins. Lysine methylation plays a central part in how histones interact with proteins.[9] Lysine methylation can be reverted by lysine demethylases (PKDMs).[8]

Different SET domain-containing proteins possess distinct substrate specificities. For example, SET1, SET7 and MLL methylate lysine 4 of histone H3, whereas Suv39h1, ESET and G9a specifically methylate lysine 9 of histone H3. Methylation at lysine 4 and lysine 9 are mutually exclusive and the epigenetic consequences of site-specific methylation are diametrically opposed: Methylation at lysine 4 correlates with an active state of transcription, whereas methylation at lysine 9 is associated with transcriptional repression and heterochromatin. Other lysine residues on histone H3 and histone H4 are also important sites of methylation by specific SET domain-containing enzymes. Although histones are the prime target of lysine methyltransferases, other cellular proteins carry N-methyllysine residues, including elongation factor 1A and the calcium sensing protein calmodulin.[9]

N-terminal methylation[edit]

Many eukaryotic proteins are post-translationally modified on their N-terminus. A common form of N-terminal modification is N-terminal methylation (Nt-methylation) by N-terminal methyltransferases (NTMTs). Proteins containing the consensus motif H2N-X-Pro-Lys- (where X can be Ala, Pro or Ser) after removal of the initiator methionine (iMet) can be subject to N-terminal α-amino-methylation.[10] Monomethylation may have slight effects on α-amino nitrogen nucleophilicity and basicity, whereas trimethylation (or dimethylation in case of proline) will result in abolition of nucleophilicity and a permanent positive charge on the N-terminal amino group. Although from a biochemical point of view demethylation of amines is possible, Nt-methylation is considered irreversible as no N-terminal demethylase has been described to date.[10] Histone variants CENP-A and CENP-B have been found to be Nt-methylated in vivo.[10]

Prenylcysteine[edit]

Eukaryotic proteins with C-termini that end in a CAAX motif are often subjected to a series of posttranslational modifications. The CAAX-tail processing takes place in three steps: First, a prenyl lipid anchor is attached to the cysteine through a thioester linkage. Then endoproteolysis occurs to remove the last three amino acids of the protein to expose the prenylcysteine α-COOH group. Finally, the exposed prenylcysteine group is methylated. The importance of this modification can be seen in targeted disruption of the methyltransferase for mouse CAAX proteins, where loss of isoprenylcysteine carboxyl methyltransferase resulted in mid-gestation lethality.[11]

The biological function of prenylcysteine methylation is to facilitate the targeting of CAAX proteins to membrane surfaces within cells. Prenylcysteine can be demethylated and this reverse reaction is catalyzed by isoprenylcysteine carboxyl methylesterases. CAAX box containing proteins that are prenylcysteine methylated include Ras, GTP-binding proteins, nuclear lamins and certain protein kinases. Many of these proteins participate in cell signaling, and they utilize prenylcysteine methylation to concentrate them on the cytosolic surface of the plasma membrane where they are functional.[11]

Methylations on the C-terminus can increase a protein's chemical repertoire[12] and are known to have a major effect on the functions of a protein.[1]

Protein phosphatase 2[edit]

In eukaryotic cells, phosphatases catalyze the removal of phosphate groups from tyrosine, serine and threonine phosphoproteins. The catalytic subunit of the major serine/threonine phosphatases, like Protein phosphatase 2 is covalently modified by the reversible methylation of its C-terminus to form a leucine carboxy methyl ester. Unlike CAAX motif methylation, no C-terminal processing is required to facilitate methylation. This C-terminal methylation event regulates the recruitment of regulatory proteins into complexes through the stimulation of protein–protein interactions, thus indirectly regulating the activity of the serine-threonine phosphatases complex.[13] Methylation is catalyzed by a unique protein phosphatase methyltransferase. The methyl group is removed by a specific protein phosphatase methylesterase. These two opposed enzymes make serine-threonine phosphatases methylation a dynamic process in response to stimuli.[13]

L-isoaspartyl[edit]

Damaged proteins accumulate isoaspartyl which causes protein instability, loss of biological activity and stimulation of autoimmune responses. The spontaneous age-dependent degradation of L-aspartyl residues results in the formation of a succinimidyl intermediate, a succinimide radical. This is spontaneously hydrolyzed either back to L-aspartyl or, in a more favorable reaction, to abnormal L-isoaspartyl. A methyltransferase dependent pathway exists for the conversion of L-isoaspartyl back to L-aspartyl. To prevent the accumulation of L-isoaspartyl, this residue is methylated by the protein L-isoaspartyl methyltransferase, which catalyzes the formation of a methyl ester, which in turn is converted back to a succinimidyl intermediate.[14] Loss and gain of function mutations have unmasked the biological importance of the L-isoaspartyl O-methyltransferase in age-related processes: Mice lacking the enzyme die young of fatal epilepsy, whereas flies engineered to over-express it have an increase in life span of over 30%.[14]

Physical effects[edit]

A common theme with methylated proteins, as with phosphorylated proteins, is the role this modification plays in the regulation of protein–protein interactions. The arginine methylation of proteins can either inhibit or promote protein–protein interactions depending on the type of methylation. The asymmetric dimethylation of arginine residues in close proximity to proline-rich motifs can inhibit the binding to SH3 domains.[15] The opposite effect is seen with interactions between the survival of motor neurons protein and the snRNP proteins SmD1, SmD3 and SmB/B', where binding is promoted by symmetric dimethylation of arginine residues in the snRNP proteins.[16]

A well-characterized example of a methylation dependent protein–protein interaction is related to the selective methylation of lysine 9, by SUV39H1 on the N-terminal tail of the histone H3.[9] Di- and tri-methylation of this lysine residue facilitates the binding of heterochromatin protein 1 (HP1). Because HP1 and Suv39h1 interact, it is thought the binding of HP1 to histone H3 is maintained and even allowed that to spread along the chromatin. The HP1 protein harbors a chromodomain which is responsible for the methyl-dependent interaction between it and lysine 9 of histone H3. It is likely that additional chromodomain-containing proteins will bind the same site as HP1, and to other lysine methylated positions on histones H3 and Histone H4.[13]

C-terminal protein methylation regulates the assembly of protein phosphatase. Methylation of the protein phosphatase 2A catalytic subunit enhances the binding of the regulatory B subunit and facilitates holoenzyme assembly.[13]

References[edit]

  1. ^ abSchubert, H.; Blumenthal, R.; Cheng, X. (2007). "1 Protein methyltransferases: Their distribution among the five structural classes of adomet-dependent methyltransferases 1". The Enzymes. 24: 3–22. doi:10.1016/S1874-6047(06)80003-X. ISBN . PMID 26718035.
  2. ^Walsh, Christopher (2006). "Chapter 5 – Protein Methylation"(PDF). Posttranslational modification of proteins: expanding nature's inventory. Roberts and Co. Publishers. ISBN . Archived from the original(PDF) on 2009-12-29.
  3. ^Grewal, S. I.; Rice, J. C. (2004). "Regulation of heterochromatin by histone methylation and small RNAs". Current Opinion in Cell Biology. 16 (3): 230–238. doi:10.1016/j.ceb.2004.04.002. PMID 15145346.
  4. ^Nakayama, J. -I.; Rice, J. C.; Strahl, B. D.; Allis, C. D.; Grewal, S. I. (2001). "Role of Histone H3 Lysine 9 Methylation in Epigenetic Control of Heterochromatin Assembly". Science. 292 (5514): 110–113. Bibcode:2001Sci...292..110N. doi:10.1126/science.1060118. PMID 11283354. S2CID 16975534.
  5. ^ abcBlanc, Roméo S.; Richard, Stéphane (2017). "Arginine Methylation: The Coming of Age". Molecular Cell. 65 (1): 8–24. doi:10.1016/j.molcel.2016.11.003. PMID 28061334.
  6. ^ abcMcBride, A.; Silver, P. (2001). "State of the Arg: Protein Methylation at Arginine Comes of Age". Cell. 106 (1): 5–8. doi:10.1016/S0092-8674(01)00423-8. PMID 11461695. S2CID 17755108.
  7. ^Bedford, Mark T.; Clarke, Steven G. (2009). "Protein Arginine Methylation in Mammals: Who, What, and Why". Molecular Cell. 33 (1): 1–13. doi:10.1016/j.molcel.2008.12.013. PMC 3372459. PMID 19150423.
  8. ^ abWang, Yu-Chieh; Peterson, Suzanne E.; Loring, Jeanne F. (2013). "Protein post-translational modifications and regulation of pluripotency in human stem cells". Cell Research. 24 (2): 143–160. doi:10.1038/cr.2013.151. PMC 3915910. PMID 24217768.
  9. ^ abcKouzarides, T (2002). "Histone methylation in transcriptional control". Current Opinion in Genetics & Development. 12 (2): 198–209. doi:10.1016/S0959-437X(02)00287-3. PMID 11893494.
  10. ^ abcVarland, Sylvia; Osberg, Camilla; Arnesen, Thomas (2015). "N-terminal modifications of cellular proteins: The enzymes involved, their substrate specificities and biological effects". Proteomics. 15 (14): 2385–2401. doi:10.1002/pmic.201400619. PMC 4692089. PMID 25914051.
  11. ^ abBergo, M (2000). "Isoprenylcysteine Carboxyl Methyltransferase Deficiency in Mice". Journal of Biological Chemistry. 276 (8): 5841–5845. doi:10.1074/jbc.c000831200. PMID 11121396.
  12. ^Clarke, S (1993). "Protein methylation". Curr. Opin. Cell Biol. 5 (6): 977–83. doi:10.1016/0955-0674(93)90080-A. PMID 8129951.
  13. ^ abcdTolstykh, T (2000). "Carboxyl methylation regulates phosphoprotein phosphatase 2A by controlling the association of regulatory B subunits". The EMBO Journal. 19 (21): 5682–5691. doi:10.1093/emboj/19.21.5682. PMC 305779. PMID 11060019.
  14. ^ abClarke, S (2003). "Aging as war between chemical and biochemical processes: Protein methylation and the recognition of age-damaged proteins for repair". Ageing Research Reviews. 2 (3): 263–285. doi:10.1016/S1568-1637(03)00011-4. PMID 12726775. S2CID 18135051.
  15. ^Bedford, M (2000). "Arginine Methylation Inhibits the Binding of Proline-rich Ligands to Src Homology 3, but Not WW, Domains". Journal of Biological Chemistry. 275 (21): 16030–16036. doi:10.1074/jbc.m909368199. PMID 10748127.
  16. ^Friesen, W.; Massenet, S.; Paushkin, S.; Wyce, A.; Dreyfuss, G. (2001). "SMN, the Product of the Spinal Muscular Atrophy Gene, Binds Preferentially to Dimethylarginine-Containing Protein Targets". Molecular Cell. 7 (5): 1111–1117. doi:10.1016/S1097-2765(01)00244-1. PMID 11389857.
Sours: https://en.wikipedia.org/wiki/Protein_methylation

Methylation amino acid

Protein Methylation Service


Protein methylation is a post-translational modification (PTM) process, in which highly specific enzymes called methyltransferases are responsible for the addition of methyl groups to a targeted molecule and S-adenosyl methionine (SAM) as the primary donor of methyl group. Protein methylation commonly occurs on arginine, lysine, histidine, proline, and carboxyl groups. Protein methylation plays an important role in modulating cellular and biological processes, including transcriptional regulation, RNA processing, metabolism and signal transduction.

protein-methylation-analysis-1.jpg

Figure 1. Types of methylation on arginine residues (Yang Y and Bedford M T, 2013).

Overview of Protein Methylation Service

Creative Proteomics has already developed a highly sensitive HPLC-MS/MS pipeline that can analyze N- and O-methylation. With powerful and sensitive tools, we can identify, quantify and characterize protein methylation. Metabolic labeling strategies can be coupled with MS to measure dynamic and differential in vivo protein methylation rates. In addition, we also provide bioinformatics services in Protein Post-translational Modification Analysis. We have optimized our protocol to enable more fast and sensitive services for methylation analysis. Shown as Figure 2, our protein methylation service contains digestion, enrichment, LC-MS/MS analysis, and data analysis. 

protein-methylation-analysis-2.jpg

Figure 2. The workflow of protein methylation analysis. 

Sample Requirements

  • Plant roots, xylem, phloem, etc.: 5g or more
  • Animal tissues: wet weight >200 mg
  • Microorganisms: wet weight > 2 g
  • Body fluids (saliva, amniotic fluid, cerebrospinal fluid, etc.): 10 mL or more
  • Serum: 500 μL or more
  • Urine: 50 mL or more
  • Protein extract: concentration > 2 mg/mL, total not less than 1 mg. In order to ensure the test results, please inform the buffer components, whether it contains thiourea, SDS, or strong ion salts. In addition, the sample should not contain components such as nucleic acids, lipids, and polysaccharides, which will affect the separation effect.

If you want to know specific samples requirements, please feel free to contact us.

Delivery

  • Detailed report, including experimental materials, methods, procedures, and results
  • Raw data and data analysis result

Our Advantages

  • High-throughput: Identify and quantify up to thousands of proteins at once
  • 100% coverage: Use 2-3 enzymes for protein digestion to ensure full-coverage
  • Ability to analyze low abundance ubiquitin-proteins
  • State-of-the-art facilities: Triple TOF 5600, Q-Exactive, Orbitrap Fusion Tribrid
  • Constantly optimized and validated protocol

Technology platforms

Matrix Assisted Laser Desorption Ionization Mass Spectrometry (MALDI-MS)

At Creative Proteomics, many excellent and experienced experts will optimize the experimental protocol according to your requirement and guarantee the high-quality results for protein methylation analysis. As every project has different requirements, please contact our specialists to discuss your specific needs. 

Reference

1. Yang Y, Bedford M T. Protein arginine methyltransferases and cancer. Nature Reviews Cancer, 2013, 13(1): 37.


* For Research Use Only. Not for use in diagnostic procedures.

Our customer service representatives are available 24 hours a day, 7 days a week. Inquiry

Related Sections

Services

Resource

Online Inquiry

Please submit a detailed description of your project. We will provide you with a customized project plan to meet your research requests. You can also send emails directly to for inquiries.

Sours: https://www.creative-proteomics.com/services/methylation-2.htm
Transmethylation

To fall into some other reality. I always perceived him as a friend, and did not admit the thought that Pashka could be not only my friend. Moreover, this is not my type of man.

You will also like:

Five years passed without a trace for her. Olya was still the same: the same hair, eyes, a smile, the same voice with a slight hoarseness, the same hands. Yes, and she recognized me. Always strict, critical, even, one might say, sometimes rude and arrogant, she smiled at me as if I were a good friend. We exchanged a couple of phrases with her, and she, leaving me, ended our dialogue with a joke.



470 471 472 473 474